ID: 1058696047 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:107559794-107559816 |
Sequence | TTAGGCAACTCTGATAGTTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1058696045_1058696047 | -7 | Left | 1058696045 | 9:107559778-107559800 | CCTGATACAGGGTCACTTAGGCA | No data | ||
Right | 1058696047 | 9:107559794-107559816 | TTAGGCAACTCTGATAGTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1058696047 | Original CRISPR | TTAGGCAACTCTGATAGTTT GGG | Intergenic | ||