ID: 1058696047

View in Genome Browser
Species Human (GRCh38)
Location 9:107559794-107559816
Sequence TTAGGCAACTCTGATAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058696045_1058696047 -7 Left 1058696045 9:107559778-107559800 CCTGATACAGGGTCACTTAGGCA No data
Right 1058696047 9:107559794-107559816 TTAGGCAACTCTGATAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058696047 Original CRISPR TTAGGCAACTCTGATAGTTT GGG Intergenic
No off target data available for this crispr