ID: 1058700964

View in Genome Browser
Species Human (GRCh38)
Location 9:107599848-107599870
Sequence CACTGTGGCCCTTCCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058700959_1058700964 4 Left 1058700959 9:107599821-107599843 CCGGGGGTGACAATGTTTCTCAG No data
Right 1058700964 9:107599848-107599870 CACTGTGGCCCTTCCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058700964 Original CRISPR CACTGTGGCCCTTCCTGTCC TGG Intergenic
No off target data available for this crispr