ID: 1058711311

View in Genome Browser
Species Human (GRCh38)
Location 9:107681826-107681848
Sequence GAGAGCTCAGCGTTGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058711305_1058711311 24 Left 1058711305 9:107681779-107681801 CCAGGAGAGGGTCGGCTGGAGAA No data
Right 1058711311 9:107681826-107681848 GAGAGCTCAGCGTTGGTCCCTGG No data
1058711307_1058711311 -1 Left 1058711307 9:107681804-107681826 CCAACTGAGAAAGCCTGAAAGGG No data
Right 1058711311 9:107681826-107681848 GAGAGCTCAGCGTTGGTCCCTGG No data
1058711304_1058711311 25 Left 1058711304 9:107681778-107681800 CCCAGGAGAGGGTCGGCTGGAGA No data
Right 1058711311 9:107681826-107681848 GAGAGCTCAGCGTTGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058711311 Original CRISPR GAGAGCTCAGCGTTGGTCCC TGG Intergenic
No off target data available for this crispr