ID: 1058719450

View in Genome Browser
Species Human (GRCh38)
Location 9:107750335-107750357
Sequence TAGTATCACTTTAACCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058719450_1058719453 9 Left 1058719450 9:107750335-107750357 CCCATTTGGTTAAAGTGATACTA No data
Right 1058719453 9:107750367-107750389 AGAGGTTAGAAATTTTCCCAAGG No data
1058719450_1058719452 -9 Left 1058719450 9:107750335-107750357 CCCATTTGGTTAAAGTGATACTA No data
Right 1058719452 9:107750349-107750371 GTGATACTAAATCTTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058719450 Original CRISPR TAGTATCACTTTAACCAAAT GGG (reversed) Intergenic
No off target data available for this crispr