ID: 1058719883

View in Genome Browser
Species Human (GRCh38)
Location 9:107754210-107754232
Sequence TGCCAAGCAAAAGGCGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058719883_1058719887 7 Left 1058719883 9:107754210-107754232 CCTTTTCCGCCTTTTGCTTGGCA No data
Right 1058719887 9:107754240-107754262 TTGCTGCCACCATGTGAAGAAGG 0: 199
1: 532
2: 1436
3: 2035
4: 2285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058719883 Original CRISPR TGCCAAGCAAAAGGCGGAAA AGG (reversed) Intergenic
No off target data available for this crispr