ID: 1058719887

View in Genome Browser
Species Human (GRCh38)
Location 9:107754240-107754262
Sequence TTGCTGCCACCATGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6487
Summary {0: 199, 1: 532, 2: 1436, 3: 2035, 4: 2285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058719883_1058719887 7 Left 1058719883 9:107754210-107754232 CCTTTTCCGCCTTTTGCTTGGCA No data
Right 1058719887 9:107754240-107754262 TTGCTGCCACCATGTGAAGAAGG 0: 199
1: 532
2: 1436
3: 2035
4: 2285
1058719884_1058719887 1 Left 1058719884 9:107754216-107754238 CCGCCTTTTGCTTGGCACTTCTC 0: 86
1: 227
2: 341
3: 403
4: 620
Right 1058719887 9:107754240-107754262 TTGCTGCCACCATGTGAAGAAGG 0: 199
1: 532
2: 1436
3: 2035
4: 2285
1058719885_1058719887 -2 Left 1058719885 9:107754219-107754241 CCTTTTGCTTGGCACTTCTCCTT 0: 148
1: 333
2: 641
3: 677
4: 1394
Right 1058719887 9:107754240-107754262 TTGCTGCCACCATGTGAAGAAGG 0: 199
1: 532
2: 1436
3: 2035
4: 2285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058719887 Original CRISPR TTGCTGCCACCATGTGAAGA AGG Intergenic
Too many off-targets to display for this crispr