ID: 1058720938

View in Genome Browser
Species Human (GRCh38)
Location 9:107763004-107763026
Sequence AAATATAGGCAAAAGTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058720938_1058720940 15 Left 1058720938 9:107763004-107763026 CCATGCAACTTTTGCCTATATTT No data
Right 1058720940 9:107763042-107763064 AGTTTTTTCATCTGTAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058720938 Original CRISPR AAATATAGGCAAAAGTTGCA TGG (reversed) Intergenic
No off target data available for this crispr