ID: 1058722156

View in Genome Browser
Species Human (GRCh38)
Location 9:107773933-107773955
Sequence CAAAATGCTGACAGTTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058722156_1058722160 4 Left 1058722156 9:107773933-107773955 CCCATATAACTGTCAGCATTTTG No data
Right 1058722160 9:107773960-107773982 CAACCATTTAACAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058722156 Original CRISPR CAAAATGCTGACAGTTATAT GGG (reversed) Intergenic
No off target data available for this crispr