ID: 1058722160

View in Genome Browser
Species Human (GRCh38)
Location 9:107773960-107773982
Sequence CAACCATTTAACAAGTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058722154_1058722160 24 Left 1058722154 9:107773913-107773935 CCTCAGCCTGGACTTCATTGCCC 0: 12
1: 519
2: 1319
3: 1710
4: 1681
Right 1058722160 9:107773960-107773982 CAACCATTTAACAAGTCTCTAGG No data
1058722157_1058722160 3 Left 1058722157 9:107773934-107773956 CCATATAACTGTCAGCATTTTGA 0: 2
1: 12
2: 206
3: 1496
4: 2222
Right 1058722160 9:107773960-107773982 CAACCATTTAACAAGTCTCTAGG No data
1058722155_1058722160 18 Left 1058722155 9:107773919-107773941 CCTGGACTTCATTGCCCATATAA No data
Right 1058722160 9:107773960-107773982 CAACCATTTAACAAGTCTCTAGG No data
1058722153_1058722160 27 Left 1058722153 9:107773910-107773932 CCACCTCAGCCTGGACTTCATTG 0: 490
1: 1361
2: 1982
3: 1478
4: 1076
Right 1058722160 9:107773960-107773982 CAACCATTTAACAAGTCTCTAGG No data
1058722156_1058722160 4 Left 1058722156 9:107773933-107773955 CCCATATAACTGTCAGCATTTTG No data
Right 1058722160 9:107773960-107773982 CAACCATTTAACAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058722160 Original CRISPR CAACCATTTAACAAGTCTCT AGG Intergenic
No off target data available for this crispr