ID: 1058725786

View in Genome Browser
Species Human (GRCh38)
Location 9:107802669-107802691
Sequence GAGGGCAAACAATCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058725778_1058725786 16 Left 1058725778 9:107802630-107802652 CCAGGTCTCTCTTTTGTAGATGT No data
Right 1058725786 9:107802669-107802691 GAGGGCAAACAATCTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058725786 Original CRISPR GAGGGCAAACAATCTGGGGA GGG Intergenic
No off target data available for this crispr