ID: 1058727400

View in Genome Browser
Species Human (GRCh38)
Location 9:107817373-107817395
Sequence TTAATTCTTAACCAGCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058727400_1058727406 27 Left 1058727400 9:107817373-107817395 CCAAGATGCTGGTTAAGAATTAA No data
Right 1058727406 9:107817423-107817445 ACCTATAATCCCAGCACTTTGGG 0: 6588
1: 101778
2: 322380
3: 233931
4: 142133
1058727400_1058727405 26 Left 1058727400 9:107817373-107817395 CCAAGATGCTGGTTAAGAATTAA No data
Right 1058727405 9:107817422-107817444 CACCTATAATCCCAGCACTTTGG 0: 6178
1: 87471
2: 224511
3: 254762
4: 197112
1058727400_1058727408 30 Left 1058727400 9:107817373-107817395 CCAAGATGCTGGTTAAGAATTAA No data
Right 1058727408 9:107817426-107817448 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
1058727400_1058727403 -1 Left 1058727400 9:107817373-107817395 CCAAGATGCTGGTTAAGAATTAA No data
Right 1058727403 9:107817395-107817417 AAATTCTCGGCCAGGCACAGTGG No data
1058727400_1058727402 -9 Left 1058727400 9:107817373-107817395 CCAAGATGCTGGTTAAGAATTAA No data
Right 1058727402 9:107817387-107817409 AAGAATTAAAATTCTCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058727400 Original CRISPR TTAATTCTTAACCAGCATCT TGG (reversed) Intergenic
No off target data available for this crispr