ID: 1058727402

View in Genome Browser
Species Human (GRCh38)
Location 9:107817387-107817409
Sequence AAGAATTAAAATTCTCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058727400_1058727402 -9 Left 1058727400 9:107817373-107817395 CCAAGATGCTGGTTAAGAATTAA No data
Right 1058727402 9:107817387-107817409 AAGAATTAAAATTCTCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058727402 Original CRISPR AAGAATTAAAATTCTCGGCC AGG Intergenic
No off target data available for this crispr