ID: 1058732585

View in Genome Browser
Species Human (GRCh38)
Location 9:107864531-107864553
Sequence TGCTTCTCAGGTTTTCCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058732577_1058732585 0 Left 1058732577 9:107864508-107864530 CCGTGTCAACTCCCCCAGGTTCC No data
Right 1058732585 9:107864531-107864553 TGCTTCTCAGGTTTTCCCTAGGG No data
1058732575_1058732585 9 Left 1058732575 9:107864499-107864521 CCTATGAGTCCGTGTCAACTCCC No data
Right 1058732585 9:107864531-107864553 TGCTTCTCAGGTTTTCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058732585 Original CRISPR TGCTTCTCAGGTTTTCCCTA GGG Intergenic