ID: 1058737065

View in Genome Browser
Species Human (GRCh38)
Location 9:107903567-107903589
Sequence CTTCAGAGATAGCCCGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058737062_1058737065 -4 Left 1058737062 9:107903548-107903570 CCTCAGCCAATAAGCGTGGCTTC No data
Right 1058737065 9:107903567-107903589 CTTCAGAGATAGCCCGTGGACGG No data
1058737063_1058737065 -10 Left 1058737063 9:107903554-107903576 CCAATAAGCGTGGCTTCAGAGAT No data
Right 1058737065 9:107903567-107903589 CTTCAGAGATAGCCCGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058737065 Original CRISPR CTTCAGAGATAGCCCGTGGA CGG Intergenic
No off target data available for this crispr