ID: 1058745008

View in Genome Browser
Species Human (GRCh38)
Location 9:107981911-107981933
Sequence GAAAATGCATGGATGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058745008_1058745013 -1 Left 1058745008 9:107981911-107981933 CCCAGCCTCATCCATGCATTTTC No data
Right 1058745013 9:107981933-107981955 CTTCCACACCTCCTTCCGGCCGG No data
1058745008_1058745012 -5 Left 1058745008 9:107981911-107981933 CCCAGCCTCATCCATGCATTTTC No data
Right 1058745012 9:107981929-107981951 TTTTCTTCCACACCTCCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058745008 Original CRISPR GAAAATGCATGGATGAGGCT GGG (reversed) Intergenic
No off target data available for this crispr