ID: 1058746758

View in Genome Browser
Species Human (GRCh38)
Location 9:107999168-107999190
Sequence TGTAATGCGACACCGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746758_1058746766 21 Left 1058746758 9:107999168-107999190 CCTGCCCACGGTGTCGCATTACA No data
Right 1058746766 9:107999212-107999234 TCCTAAGTGCCCTCGGGACACGG No data
1058746758_1058746764 14 Left 1058746758 9:107999168-107999190 CCTGCCCACGGTGTCGCATTACA No data
Right 1058746764 9:107999205-107999227 TCTTCTCTCCTAAGTGCCCTCGG No data
1058746758_1058746769 30 Left 1058746758 9:107999168-107999190 CCTGCCCACGGTGTCGCATTACA No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746758_1058746765 15 Left 1058746758 9:107999168-107999190 CCTGCCCACGGTGTCGCATTACA No data
Right 1058746765 9:107999206-107999228 CTTCTCTCCTAAGTGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746758 Original CRISPR TGTAATGCGACACCGTGGGC AGG (reversed) Intergenic
No off target data available for this crispr