ID: 1058746760

View in Genome Browser
Species Human (GRCh38)
Location 9:107999173-107999195
Sequence TTGGATGTAATGCGACACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746760_1058746765 10 Left 1058746760 9:107999173-107999195 CCACGGTGTCGCATTACATCCAA No data
Right 1058746765 9:107999206-107999228 CTTCTCTCCTAAGTGCCCTCGGG No data
1058746760_1058746766 16 Left 1058746760 9:107999173-107999195 CCACGGTGTCGCATTACATCCAA No data
Right 1058746766 9:107999212-107999234 TCCTAAGTGCCCTCGGGACACGG No data
1058746760_1058746764 9 Left 1058746760 9:107999173-107999195 CCACGGTGTCGCATTACATCCAA No data
Right 1058746764 9:107999205-107999227 TCTTCTCTCCTAAGTGCCCTCGG No data
1058746760_1058746769 25 Left 1058746760 9:107999173-107999195 CCACGGTGTCGCATTACATCCAA No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746760 Original CRISPR TTGGATGTAATGCGACACCG TGG (reversed) Intergenic