ID: 1058746761

View in Genome Browser
Species Human (GRCh38)
Location 9:107999192-107999214
Sequence GGAGAGAAGAGGTGCATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746761_1058746764 -10 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746764 9:107999205-107999227 TCTTCTCTCCTAAGTGCCCTCGG No data
1058746761_1058746766 -3 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746766 9:107999212-107999234 TCCTAAGTGCCCTCGGGACACGG No data
1058746761_1058746775 25 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746775 9:107999240-107999262 CAGGATTCCAGGTAGCTGAGGGG No data
1058746761_1058746772 23 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746772 9:107999238-107999260 TCCAGGATTCCAGGTAGCTGAGG No data
1058746761_1058746769 6 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746761_1058746765 -9 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746765 9:107999206-107999228 CTTCTCTCCTAAGTGCCCTCGGG No data
1058746761_1058746776 26 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746761_1058746774 24 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746774 9:107999239-107999261 CCAGGATTCCAGGTAGCTGAGGG No data
1058746761_1058746771 14 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746771 9:107999229-107999251 ACACGGAATTCCAGGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746761 Original CRISPR GGAGAGAAGAGGTGCATGGT TGG (reversed) Intergenic
No off target data available for this crispr