ID: 1058746762

View in Genome Browser
Species Human (GRCh38)
Location 9:107999196-107999218
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746762_1058746776 22 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746762_1058746766 -7 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746766 9:107999212-107999234 TCCTAAGTGCCCTCGGGACACGG No data
1058746762_1058746774 20 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746774 9:107999239-107999261 CCAGGATTCCAGGTAGCTGAGGG No data
1058746762_1058746771 10 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746771 9:107999229-107999251 ACACGGAATTCCAGGATTCCAGG No data
1058746762_1058746775 21 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746775 9:107999240-107999262 CAGGATTCCAGGTAGCTGAGGGG No data
1058746762_1058746769 2 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746762_1058746772 19 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746772 9:107999238-107999260 TCCAGGATTCCAGGTAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746762 Original CRISPR CTTAGGAGAGAAGAGGTGCA TGG (reversed) Intergenic