ID: 1058746763

View in Genome Browser
Species Human (GRCh38)
Location 9:107999203-107999225
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746763_1058746775 14 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746775 9:107999240-107999262 CAGGATTCCAGGTAGCTGAGGGG No data
1058746763_1058746776 15 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746763_1058746772 12 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746772 9:107999238-107999260 TCCAGGATTCCAGGTAGCTGAGG No data
1058746763_1058746774 13 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746774 9:107999239-107999261 CCAGGATTCCAGGTAGCTGAGGG No data
1058746763_1058746769 -5 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746763_1058746771 3 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746771 9:107999229-107999251 ACACGGAATTCCAGGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746763 Original CRISPR GAGGGCACTTAGGAGAGAAG AGG (reversed) Intergenic