ID: 1058746765

View in Genome Browser
Species Human (GRCh38)
Location 9:107999206-107999228
Sequence CTTCTCTCCTAAGTGCCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746759_1058746765 11 Left 1058746759 9:107999172-107999194 CCCACGGTGTCGCATTACATCCA No data
Right 1058746765 9:107999206-107999228 CTTCTCTCCTAAGTGCCCTCGGG No data
1058746761_1058746765 -9 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746765 9:107999206-107999228 CTTCTCTCCTAAGTGCCCTCGGG No data
1058746758_1058746765 15 Left 1058746758 9:107999168-107999190 CCTGCCCACGGTGTCGCATTACA No data
Right 1058746765 9:107999206-107999228 CTTCTCTCCTAAGTGCCCTCGGG No data
1058746760_1058746765 10 Left 1058746760 9:107999173-107999195 CCACGGTGTCGCATTACATCCAA No data
Right 1058746765 9:107999206-107999228 CTTCTCTCCTAAGTGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746765 Original CRISPR CTTCTCTCCTAAGTGCCCTC GGG Intergenic
No off target data available for this crispr