ID: 1058746767

View in Genome Browser
Species Human (GRCh38)
Location 9:107999213-107999235
Sequence TCCGTGTCCCGAGGGCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746767_1058746775 4 Left 1058746767 9:107999213-107999235 CCTAAGTGCCCTCGGGACACGGA No data
Right 1058746775 9:107999240-107999262 CAGGATTCCAGGTAGCTGAGGGG No data
1058746767_1058746776 5 Left 1058746767 9:107999213-107999235 CCTAAGTGCCCTCGGGACACGGA No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746767_1058746771 -7 Left 1058746767 9:107999213-107999235 CCTAAGTGCCCTCGGGACACGGA No data
Right 1058746771 9:107999229-107999251 ACACGGAATTCCAGGATTCCAGG No data
1058746767_1058746772 2 Left 1058746767 9:107999213-107999235 CCTAAGTGCCCTCGGGACACGGA No data
Right 1058746772 9:107999238-107999260 TCCAGGATTCCAGGTAGCTGAGG No data
1058746767_1058746774 3 Left 1058746767 9:107999213-107999235 CCTAAGTGCCCTCGGGACACGGA No data
Right 1058746774 9:107999239-107999261 CCAGGATTCCAGGTAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746767 Original CRISPR TCCGTGTCCCGAGGGCACTT AGG (reversed) Intergenic