ID: 1058746768

View in Genome Browser
Species Human (GRCh38)
Location 9:107999221-107999243
Sequence CCTGGAATTCCGTGTCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746768_1058746776 -3 Left 1058746768 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746768_1058746774 -5 Left 1058746768 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
Right 1058746774 9:107999239-107999261 CCAGGATTCCAGGTAGCTGAGGG No data
1058746768_1058746775 -4 Left 1058746768 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
Right 1058746775 9:107999240-107999262 CAGGATTCCAGGTAGCTGAGGGG No data
1058746768_1058746772 -6 Left 1058746768 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
Right 1058746772 9:107999238-107999260 TCCAGGATTCCAGGTAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746768 Original CRISPR CCTGGAATTCCGTGTCCCGA GGG (reversed) Intergenic