ID: 1058746769

View in Genome Browser
Species Human (GRCh38)
Location 9:107999221-107999243
Sequence CCCTCGGGACACGGAATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746759_1058746769 26 Left 1058746759 9:107999172-107999194 CCCACGGTGTCGCATTACATCCA No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746760_1058746769 25 Left 1058746760 9:107999173-107999195 CCACGGTGTCGCATTACATCCAA No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746761_1058746769 6 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746762_1058746769 2 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746758_1058746769 30 Left 1058746758 9:107999168-107999190 CCTGCCCACGGTGTCGCATTACA No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
1058746763_1058746769 -5 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746769 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746769 Original CRISPR CCCTCGGGACACGGAATTCC AGG Intergenic
No off target data available for this crispr