ID: 1058746771

View in Genome Browser
Species Human (GRCh38)
Location 9:107999229-107999251
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746761_1058746771 14 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746771 9:107999229-107999251 ACACGGAATTCCAGGATTCCAGG No data
1058746763_1058746771 3 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746771 9:107999229-107999251 ACACGGAATTCCAGGATTCCAGG No data
1058746767_1058746771 -7 Left 1058746767 9:107999213-107999235 CCTAAGTGCCCTCGGGACACGGA No data
Right 1058746771 9:107999229-107999251 ACACGGAATTCCAGGATTCCAGG No data
1058746762_1058746771 10 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746771 9:107999229-107999251 ACACGGAATTCCAGGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746771 Original CRISPR ACACGGAATTCCAGGATTCC AGG Intergenic