ID: 1058746776

View in Genome Browser
Species Human (GRCh38)
Location 9:107999241-107999263
Sequence AGGATTCCAGGTAGCTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058746762_1058746776 22 Left 1058746762 9:107999196-107999218 CCATGCACCTCTTCTCTCCTAAG No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746767_1058746776 5 Left 1058746767 9:107999213-107999235 CCTAAGTGCCCTCGGGACACGGA No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746761_1058746776 26 Left 1058746761 9:107999192-107999214 CCAACCATGCACCTCTTCTCTCC No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746770_1058746776 -4 Left 1058746770 9:107999222-107999244 CCTCGGGACACGGAATTCCAGGA No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746768_1058746776 -3 Left 1058746768 9:107999221-107999243 CCCTCGGGACACGGAATTCCAGG No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data
1058746763_1058746776 15 Left 1058746763 9:107999203-107999225 CCTCTTCTCTCCTAAGTGCCCTC No data
Right 1058746776 9:107999241-107999263 AGGATTCCAGGTAGCTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058746776 Original CRISPR AGGATTCCAGGTAGCTGAGG GGG Intergenic