ID: 1058747532

View in Genome Browser
Species Human (GRCh38)
Location 9:108006766-108006788
Sequence CTGTAAACACAGAGAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058747532_1058747537 7 Left 1058747532 9:108006766-108006788 CCTTGATTTCTCTGTGTTTACAG No data
Right 1058747537 9:108006796-108006818 CTCTGGGTTCCCTTTCACTGGGG No data
1058747532_1058747533 -10 Left 1058747532 9:108006766-108006788 CCTTGATTTCTCTGTGTTTACAG No data
Right 1058747533 9:108006779-108006801 GTGTTTACAGCATTGTTCTCTGG No data
1058747532_1058747534 -9 Left 1058747532 9:108006766-108006788 CCTTGATTTCTCTGTGTTTACAG No data
Right 1058747534 9:108006780-108006802 TGTTTACAGCATTGTTCTCTGGG No data
1058747532_1058747541 21 Left 1058747532 9:108006766-108006788 CCTTGATTTCTCTGTGTTTACAG No data
Right 1058747541 9:108006810-108006832 TCACTGGGGTCACACCCTCAGGG No data
1058747532_1058747540 20 Left 1058747532 9:108006766-108006788 CCTTGATTTCTCTGTGTTTACAG No data
Right 1058747540 9:108006809-108006831 TTCACTGGGGTCACACCCTCAGG No data
1058747532_1058747536 6 Left 1058747532 9:108006766-108006788 CCTTGATTTCTCTGTGTTTACAG No data
Right 1058747536 9:108006795-108006817 TCTCTGGGTTCCCTTTCACTGGG No data
1058747532_1058747535 5 Left 1058747532 9:108006766-108006788 CCTTGATTTCTCTGTGTTTACAG No data
Right 1058747535 9:108006794-108006816 TTCTCTGGGTTCCCTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058747532 Original CRISPR CTGTAAACACAGAGAAATCA AGG (reversed) Intergenic
No off target data available for this crispr