ID: 1058758097

View in Genome Browser
Species Human (GRCh38)
Location 9:108102430-108102452
Sequence ACTCCCTCCAAGCCAACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058758097_1058758098 -3 Left 1058758097 9:108102430-108102452 CCTGAGGTTGGCTTGGAGGGAGT No data
Right 1058758098 9:108102450-108102472 AGTATGCAATAGCATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058758097 Original CRISPR ACTCCCTCCAAGCCAACCTC AGG (reversed) Intergenic
No off target data available for this crispr