ID: 1058758788

View in Genome Browser
Species Human (GRCh38)
Location 9:108109357-108109379
Sequence TAATTTCTTGACCATCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058758784_1058758788 -7 Left 1058758784 9:108109341-108109363 CCTCTACCAGGTTTGCTAATTTC No data
Right 1058758788 9:108109357-108109379 TAATTTCTTGACCATCAGTGGGG No data
1058758783_1058758788 -4 Left 1058758783 9:108109338-108109360 CCTCCTCTACCAGGTTTGCTAAT No data
Right 1058758788 9:108109357-108109379 TAATTTCTTGACCATCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058758788 Original CRISPR TAATTTCTTGACCATCAGTG GGG Intergenic
No off target data available for this crispr