ID: 1058763750

View in Genome Browser
Species Human (GRCh38)
Location 9:108161660-108161682
Sequence TGTCTCCTTCCCACGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058763750_1058763753 26 Left 1058763750 9:108161660-108161682 CCAGGACTCGTGGGAAGGAGACA No data
Right 1058763753 9:108161709-108161731 GCAAACACAAAGTTGCCCTCAGG No data
1058763750_1058763755 30 Left 1058763750 9:108161660-108161682 CCAGGACTCGTGGGAAGGAGACA No data
Right 1058763755 9:108161713-108161735 ACACAAAGTTGCCCTCAGGTGGG No data
1058763750_1058763754 29 Left 1058763750 9:108161660-108161682 CCAGGACTCGTGGGAAGGAGACA No data
Right 1058763754 9:108161712-108161734 AACACAAAGTTGCCCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058763750 Original CRISPR TGTCTCCTTCCCACGAGTCC TGG (reversed) Intergenic
No off target data available for this crispr