ID: 1058764695

View in Genome Browser
Species Human (GRCh38)
Location 9:108170196-108170218
Sequence GTAGTAGCCATTCTAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058764695_1058764698 -10 Left 1058764695 9:108170196-108170218 CCACCCATTAGAATGGCTACTAC No data
Right 1058764698 9:108170209-108170231 TGGCTACTACTTTTTTTTAATGG No data
1058764695_1058764699 7 Left 1058764695 9:108170196-108170218 CCACCCATTAGAATGGCTACTAC No data
Right 1058764699 9:108170226-108170248 TAATGGAAAATAATATGTGCTGG No data
1058764695_1058764700 18 Left 1058764695 9:108170196-108170218 CCACCCATTAGAATGGCTACTAC No data
Right 1058764700 9:108170237-108170259 AATATGTGCTGGTGAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058764695 Original CRISPR GTAGTAGCCATTCTAATGGG TGG (reversed) Intergenic
No off target data available for this crispr