ID: 1058764883

View in Genome Browser
Species Human (GRCh38)
Location 9:108172456-108172478
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058764883_1058764886 20 Left 1058764883 9:108172456-108172478 CCACTTTTTGCCCAGGATTATTT No data
Right 1058764886 9:108172499-108172521 TTAGTGTTCCTTGTAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058764883 Original CRISPR AAATAATCCTGGGCAAAAAG TGG (reversed) Intergenic
No off target data available for this crispr