ID: 1058767083

View in Genome Browser
Species Human (GRCh38)
Location 9:108192081-108192103
Sequence TTATACAAGGGGAAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058767078_1058767083 3 Left 1058767078 9:108192055-108192077 CCATTTTATAGATGAGCGAAAGA No data
Right 1058767083 9:108192081-108192103 TTATACAAGGGGAAAGTGGCTGG No data
1058767077_1058767083 4 Left 1058767077 9:108192054-108192076 CCCATTTTATAGATGAGCGAAAG No data
Right 1058767083 9:108192081-108192103 TTATACAAGGGGAAAGTGGCTGG No data
1058767076_1058767083 5 Left 1058767076 9:108192053-108192075 CCCCATTTTATAGATGAGCGAAA No data
Right 1058767083 9:108192081-108192103 TTATACAAGGGGAAAGTGGCTGG No data
1058767075_1058767083 8 Left 1058767075 9:108192050-108192072 CCTCCCCATTTTATAGATGAGCG No data
Right 1058767083 9:108192081-108192103 TTATACAAGGGGAAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058767083 Original CRISPR TTATACAAGGGGAAAGTGGC TGG Intergenic
No off target data available for this crispr