ID: 1058772856

View in Genome Browser
Species Human (GRCh38)
Location 9:108254742-108254764
Sequence GAGACACTAAATGAGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058772856_1058772858 17 Left 1058772856 9:108254742-108254764 CCTGTCATCTCATTTAGTGTCTC 0: 1
1: 0
2: 1
3: 14
4: 173
Right 1058772858 9:108254782-108254804 AATTCATCTCACTGGAAATCTGG 0: 1
1: 0
2: 3
3: 12
4: 197
1058772856_1058772857 9 Left 1058772856 9:108254742-108254764 CCTGTCATCTCATTTAGTGTCTC 0: 1
1: 0
2: 1
3: 14
4: 173
Right 1058772857 9:108254774-108254796 AGCTGATTAATTCATCTCACTGG 0: 1
1: 0
2: 0
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058772856 Original CRISPR GAGACACTAAATGAGATGAC AGG (reversed) Intergenic
905244625 1:36603928-36603950 GACACTCAAAGTGAGATGACTGG + Intergenic
907232757 1:53015374-53015396 GAGTCACTAAATGTGCTGATTGG + Intronic
907895230 1:58682502-58682524 GAAACACCAAATCAGAAGACCGG - Exonic
909105672 1:71404308-71404330 GAGACACTAAAAGATTTGAGAGG - Exonic
910053252 1:83001547-83001569 GAGAAAGTAAAAGAGATGAGGGG + Intergenic
910127023 1:83854000-83854022 GAGACACAAAATGGAAAGACAGG + Intergenic
915668468 1:157466449-157466471 GAGACACCAGAGGAGATGAGGGG + Intergenic
917318250 1:173751709-173751731 GAGACAATAAATGTGATCACAGG + Intronic
918203514 1:182289055-182289077 AATACACTTAATGAGATGAAAGG - Intergenic
919407142 1:197199872-197199894 GAAACACTAAATGAATTAACTGG - Exonic
920642245 1:207763508-207763530 GAGACACGAAAAGTGATGAGGGG - Intronic
921383688 1:214550173-214550195 AAGATGCTAAATGAGATCACAGG - Intronic
921563531 1:216687627-216687649 GAGACGCTAAATGAGAGACCAGG - Intronic
922198351 1:223379751-223379773 GTGACAGAAAATGAGATGAAAGG - Intergenic
922657380 1:227397591-227397613 GAGAGACTACAAGAGAGGACTGG - Intergenic
923221931 1:231903249-231903271 GAGGCTCTAAATCTGATGACTGG - Intronic
924755256 1:246934758-246934780 GAGACACTGAAAGAGAAAACAGG - Intergenic
1065364042 10:24917641-24917663 GAGACACCAAAAGAGCTGATGGG + Intronic
1065570633 10:27068167-27068189 GAGACACCAGAGGAGATAACTGG + Intronic
1065878857 10:30022213-30022235 AAGACACTTGATGATATGACAGG + Intronic
1066241600 10:33541793-33541815 GAGACACTCAAAGAGAAGATAGG + Intergenic
1066353677 10:34661792-34661814 CAGACAGTAAATGAGATAAGAGG + Intronic
1074139491 10:110659403-110659425 CAAACAGTCAATGAGATGACAGG + Intronic
1076049068 10:127318329-127318351 GAGCAGCCAAATGAGATGACAGG + Intronic
1076614152 10:131745107-131745129 AGGACACTAAATGGGAGGACAGG + Intergenic
1079213122 11:18481488-18481510 AAAACACTAAATGAGATGTAGGG - Intronic
1079453233 11:20615805-20615827 GTGAAAATAAATGAGATGATAGG + Intronic
1086375713 11:86198827-86198849 GAGACAGTAAAAAAGATCACTGG + Intergenic
1087463792 11:98478462-98478484 GACAAACTAAAGGATATGACTGG - Intergenic
1088140858 11:106614330-106614352 GAGACACAAAATGAGATATTAGG + Intergenic
1089233837 11:117005579-117005601 GAGTTATTAAATGACATGACTGG - Intronic
1090883020 11:130850952-130850974 GAGACACCAAATGAGATAGCAGG - Intergenic
1091502229 12:1029521-1029543 TAGAAAATAAATGAGATGACTGG + Intronic
1091954248 12:4624764-4624786 GAGTCAATAAAATAGATGACTGG + Intronic
1097693651 12:62756976-62756998 GGGACACTCAATGCTATGACTGG + Intronic
1098621841 12:72610770-72610792 GTGACATTAAATCAGATGATGGG - Intronic
1099556292 12:84111795-84111817 GAAACACTTAATATGATGACAGG + Intergenic
1100917108 12:99436827-99436849 AAGACACTAAAGGAGATGATTGG - Intronic
1103814776 12:123645858-123645880 CAGACACAAAATGGGAAGACAGG - Intronic
1105357406 13:19671298-19671320 GTGACACTAAATGTGAAGAAAGG - Intronic
1106356400 13:28987488-28987510 GAGACATGAAATGAAAAGACAGG + Intronic
1114204608 14:20557078-20557100 CAGACACTAAAAGAGATAACGGG + Exonic
1117734042 14:58751438-58751460 GACAGACTCAAGGAGATGACAGG + Intergenic
1118909197 14:70047119-70047141 AAGCCACTAAATCAGATGAGTGG + Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1120974241 14:90234970-90234992 GAGACATTAAATGACCTGTCTGG - Intergenic
1121072358 14:91036025-91036047 AAGAAACGAAATGAGTTGACAGG + Intronic
1121496756 14:94397429-94397451 GAGAAACTAAAGGAGATGCATGG + Intergenic
1202845358 14_GL000009v2_random:167511-167533 GAGATACTAAATGAAATATCTGG + Intergenic
1202914760 14_GL000194v1_random:157777-157799 GAGATACTAAATGAAATATCTGG + Intergenic
1202875429 14_GL000225v1_random:203718-203740 GAGATACTAAATGAAATATCTGG - Intergenic
1202877907 14_KI270722v1_random:24938-24960 GAGATACTAAATGAAATATCTGG - Intergenic
1125102719 15:35933563-35933585 GAGAAACTGAAGCAGATGACAGG + Intergenic
1125125860 15:36220263-36220285 GGGACAATAAATGAGAAGAGAGG - Intergenic
1131561219 15:93442115-93442137 AATACACTGAATGAGATGACAGG + Intergenic
1133583645 16:7170575-7170597 GAGAAACTAAAGGATTTGACTGG + Intronic
1133935053 16:10262308-10262330 GGGACACTAAACGACATGAAAGG + Intergenic
1139485867 16:67256269-67256291 GAGACACTGAATGGGAAGCCTGG + Intronic
1140039695 16:71397823-71397845 GAGATCCAAAATGAGATGTCTGG - Intergenic
1141491560 16:84377421-84377443 GAGACAATAAATGAGCTGTGAGG - Intronic
1143345991 17:6249551-6249573 GGAAGACTAAATGAGATGATGGG + Intergenic
1144148237 17:12419145-12419167 GAGAAAATAAATGAGATCAAAGG - Intergenic
1147047761 17:37767449-37767471 GAGGGACCAAATAAGATGACAGG - Intergenic
1147458945 17:40556442-40556464 GAGACTCTACATGTGCTGACAGG + Intronic
1147616574 17:41832299-41832321 CAGACCCTTGATGAGATGACAGG - Intronic
1149480371 17:56998661-56998683 GAGACAGTAAATGACTTGTCAGG + Intronic
1149963633 17:61139937-61139959 AAGACACAAAGTGATATGACCGG + Intronic
1150979309 17:70123873-70123895 GAGGCAATAAATGAGTTGAAAGG + Intronic
1155546384 18:26920087-26920109 GAGTCACTAAATGTAATGACAGG - Intronic
1155653859 18:28175100-28175122 GAAACAATAAATGAAGTGACAGG + Intronic
1155989171 18:32261339-32261361 GAGACGCTAAATGAGACGAATGG - Intronic
1157106141 18:44776421-44776443 GTGTCACTAAATGAAATGAGAGG - Intronic
1157119765 18:44897958-44897980 GAGACAGTAAATCAGAATACTGG + Intronic
1159889533 18:73940746-73940768 GAGACACAAAATGAGACACCTGG - Intergenic
1160247027 18:77166998-77167020 CAGGCACTAGATGAGATGCCAGG + Intergenic
1165598181 19:37029222-37029244 GAGACACAAAATAAGAAGAAAGG + Intronic
1202672769 1_KI270710v1_random:7991-8013 GAGATACTAAATGAAATATCTGG + Intergenic
933443331 2:82343483-82343505 GAGACAACAAAAGAGATGAGAGG - Intergenic
933687036 2:85149933-85149955 GTGACTCTAAATAAGATGAAGGG + Intronic
935428664 2:102949176-102949198 GAGACATTAAATGTGATCCCAGG + Intergenic
935817753 2:106863183-106863205 CAGACACAGAATGAGAGGACAGG + Intronic
940259046 2:151761494-151761516 GAGACACAAAAGGAGAAGATGGG + Intergenic
941116945 2:161482512-161482534 AAAACAATAAATCAGATGACAGG + Intronic
941486982 2:166094297-166094319 GAGCCACTTAATGAGTTGAGTGG + Intronic
942665149 2:178309591-178309613 GAAACACTTACTGAGATCACAGG - Intronic
943541321 2:189218301-189218323 TAGACACTAAATCCAATGACTGG + Intergenic
944824608 2:203468902-203468924 GAGACATTAAATGAGAAGAAAGG + Intronic
945684529 2:212953210-212953232 GAGAGACAAAATAAGATGATAGG + Intergenic
947032625 2:225815155-225815177 GAGACACACAATGAAATAACAGG - Intergenic
1171089238 20:22268367-22268389 AAGTAACTAAGTGAGATGACAGG - Intergenic
1172231618 20:33340494-33340516 GAGCCATTCAATGAGATAACAGG + Intergenic
1176634112 21:9172422-9172444 GAGATACTAAATGAAATATCTGG + Intergenic
1177963727 21:27701313-27701335 GAGACACTGATGGAGATGCCTGG - Intergenic
1178781739 21:35609893-35609915 GAGGCATGAAATGTGATGACTGG - Intronic
1179788423 21:43742086-43742108 GGGACACTCAATTAGGTGACGGG + Intronic
1180372504 22:12055230-12055252 GAGATACTAAATGAAATATCTGG - Intergenic
1180389971 22:12220433-12220455 GAGATACTAAATGAAATATCTGG + Intergenic
1180415965 22:12714047-12714069 GAGATACTAAATGAAATATCTGG - Intergenic
1180423244 22:12889888-12889910 GAGATACTAAATGAAATATCTGG - Intergenic
1182954624 22:34410717-34410739 AAGGCAATAAATGTGATGACAGG + Intergenic
1183047346 22:35230682-35230704 GAGAAATAAAATGAAATGACAGG + Intergenic
1183260141 22:36789485-36789507 GAGACAGAAAAGGAGAAGACGGG - Intergenic
1184062708 22:42093827-42093849 GAGACAATAAAAAAGATGGCAGG + Intergenic
1185243810 22:49762206-49762228 GATCCAATATATGAGATGACTGG - Intergenic
950180214 3:10906741-10906763 GAGACACTAGAGGAAATGAAAGG + Intronic
955264765 3:57431497-57431519 GAGACAATGAATGAAATAACTGG - Intronic
957101003 3:75828442-75828464 GAGATACTAAATGAAATATCTGG + Intergenic
960041265 3:113151966-113151988 GAGACACTGAGTGAGAGGAGGGG - Intergenic
962389270 3:134957954-134957976 GAGACACCAAATGGGAAGACAGG - Intronic
963041407 3:141072512-141072534 GAGACAGTAAGAGAGATGCCAGG - Intronic
965302721 3:167022643-167022665 GAGAAAATAAATGATATGATGGG + Intergenic
965904640 3:173688940-173688962 CAGACACTAAATGTGACAACAGG - Intronic
967155625 3:186689277-186689299 GGGAGATTAAATGAGATAACAGG - Intergenic
967156910 3:186701442-186701464 GGGACATTAAATGAGGTAACAGG - Intergenic
968540077 4:1163487-1163509 GAGACTCTAAAGGAGATAATAGG - Intergenic
970895754 4:21101970-21101992 GAGACACAAAAGAAGAGGACAGG + Intronic
972509560 4:39755014-39755036 GAGACAAATAATGAGATGATTGG + Intronic
974033321 4:56795724-56795746 GAGAAAGAAAAAGAGATGACAGG + Intergenic
982791036 4:159591898-159591920 GAGACACAAGATGAGACAACTGG + Intergenic
983281231 4:165682940-165682962 GAGAAGATAAAGGAGATGACAGG + Intergenic
1202754095 4_GL000008v2_random:40790-40812 GAGATACTAAATGAAATATCTGG - Intergenic
986239442 5:5944609-5944631 GAGACAGGAAATGAGATGAAAGG + Intergenic
991236132 5:64399644-64399666 AAGACACTACATGAGATAATGGG + Intergenic
991462675 5:66876203-66876225 GAGACAATAAATGAATTGCCTGG + Intronic
993588258 5:89759855-89759877 ATGAGACTAAGTGAGATGACTGG + Intergenic
994387814 5:99152617-99152639 GAGAAACAAAATGAGAGCACTGG - Intergenic
997213940 5:132095172-132095194 GAGACACTGAAAGGGATGCCAGG + Intergenic
997705513 5:135948292-135948314 CAGACACTACAAGAGATGCCAGG + Intronic
1000019403 5:157306135-157306157 GAGACACTGAAGGAGAAGAAAGG - Intronic
1000194428 5:158944176-158944198 GAGAAACTAATGTAGATGACGGG - Intronic
1003004322 6:2367000-2367022 GAGACACACACTGAGATGGCTGG - Intergenic
1004082968 6:12414052-12414074 GAGAAATGAAATGAAATGACTGG - Intergenic
1007196182 6:40062688-40062710 GAGCCACTAAATGAGGTGGGTGG - Intergenic
1009043321 6:58208430-58208452 GAAACATTAAATGTGATTACAGG - Intergenic
1009517687 6:64640834-64640856 GAGACACTAAATGTGTTTAGTGG - Intronic
1010794412 6:80102881-80102903 GAGAGAATAAAAGAGATGAGGGG - Intergenic
1011859647 6:91738689-91738711 GAGTCACTAAATGTCATGAGTGG + Intergenic
1014480587 6:121931704-121931726 AAGATGCTCAATGAGATGACAGG - Intergenic
1014633543 6:123816749-123816771 GAGACACTAGAAGAGGTGAGAGG + Intronic
1014745254 6:125193096-125193118 GAGAAGCTAACTGTGATGACTGG + Intronic
1015185539 6:130411656-130411678 GAGACACTCTATGAAATAACTGG - Intronic
1015955015 6:138589919-138589941 AAGACACTGAATGTGCTGACCGG + Intronic
1017888478 6:158620412-158620434 CAGACACTAATTCAGCTGACTGG - Intronic
1017911118 6:158793910-158793932 GAGACATTCACTGAGATGACAGG + Intronic
1018582629 6:165320337-165320359 GAGACACAAAAGTAGATGAATGG - Intergenic
1020403463 7:7804222-7804244 GAGACTATAAATGAGACCACAGG + Intronic
1021751431 7:23804815-23804837 GACACAGTAAATGAGAGGACAGG - Intronic
1021982278 7:26066423-26066445 GAGACATTCACTGAGGTGACCGG - Intergenic
1023208966 7:37782506-37782528 GAGACACCAGCTGAGATGTCAGG - Intronic
1023745415 7:43318558-43318580 GGAGCACTAAATGAGATAACTGG - Intronic
1027622146 7:80502132-80502154 GTGACAATAAATAAGAGGACAGG + Intronic
1028860401 7:95642545-95642567 GAGAAATTAGATGAGGTGACTGG + Intergenic
1029150503 7:98477049-98477071 GAGACAATGAATTAGATGGCTGG + Intergenic
1030425017 7:109365261-109365283 GAGAAAACAAATGAGATGATTGG - Intergenic
1031706691 7:124989261-124989283 GTAACACTAAATGAGAGGAAAGG - Intergenic
1033890222 7:146003317-146003339 CGGACACTAAATGAGATGACAGG - Intergenic
1035845422 8:2858980-2859002 GAGACAGTGAATGAAAAGACAGG + Intergenic
1038056316 8:23861478-23861500 GAAACACTAAATGAAAAGAAGGG - Intergenic
1039182693 8:34883862-34883884 GAAACACTAAATGAGAAGAAAGG + Intergenic
1041348078 8:56921980-56922002 GAGAGACTAAAACAGATGAGAGG + Intergenic
1042219209 8:66457042-66457064 GAGAAACGAAATGCGGTGACCGG - Intronic
1047064209 8:121262530-121262552 GAGAAAGTAAATGAAATAACTGG + Intergenic
1048406393 8:134126897-134126919 GAGACACTATATTAGAAGTCTGG - Intergenic
1050406170 9:5310474-5310496 GAGACTCTAAATGATAGGAATGG - Intergenic
1051518491 9:17957711-17957733 CAGACCCTAAATCTGATGACTGG + Intergenic
1055140548 9:72872252-72872274 AAGATATTAAATGAGAAGACAGG + Intergenic
1055735576 9:79325865-79325887 GACAGACAAAATGCGATGACAGG - Intergenic
1056688836 9:88788605-88788627 GAAAAACTAAATGGGATGAAGGG - Intergenic
1058772856 9:108254742-108254764 GAGACACTAAATGAGATGACAGG - Intergenic
1062299655 9:135858393-135858415 CAGACACTATTTCAGATGACTGG + Intronic
1203756952 Un_GL000218v1:140058-140080 GAGATACTAAATGAAATATCTGG + Intergenic
1203716332 Un_KI270742v1:152719-152741 GAGATACTAAATGAAATATCTGG + Intergenic
1203534882 Un_KI270743v1:25516-25538 GAGATACTAAATGAAATATCTGG - Intergenic
1203650562 Un_KI270751v1:116288-116310 GAGATACTAAATGAAATATCTGG + Intergenic
1187129009 X:16482761-16482783 AGGCCACTAAATGAGAAGACAGG + Intergenic
1188141251 X:26554741-26554763 GAGAGTCTAAATGACATGCCAGG + Intergenic
1188812122 X:34663478-34663500 GAAACACTAAAAGACATGAGAGG + Intergenic
1189411124 X:40772316-40772338 CAGAGACCAAATGAGAGGACAGG + Intergenic
1189748088 X:44190550-44190572 AAAACACAAAATAAGATGACAGG - Intronic
1190072865 X:47293164-47293186 GGGACACTAATTCAGCTGACTGG - Intergenic
1191690366 X:63932892-63932914 GAGAAGCTCAATGAGATGAAGGG - Intergenic
1192528355 X:71867117-71867139 GAGGCACTAAATGAGGGGAGGGG + Intergenic
1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG + Intergenic
1194980398 X:100434486-100434508 GGGATTCTAATTGAGATGACTGG + Intergenic
1195405792 X:104511799-104511821 GATACAGTAAATAAGATGATGGG - Intergenic
1196144712 X:112304151-112304173 GAGCCACAAAAAGACATGACTGG - Intergenic
1200286488 X:154827869-154827891 CAGACTCTGAATGAGCTGACAGG - Intronic
1201170524 Y:11257674-11257696 GAGATACTAAATGAAATATCTGG + Intergenic
1201917939 Y:19202871-19202893 GAGAAACAAAATGAGAGGCCAGG - Intergenic