ID: 1058773308

View in Genome Browser
Species Human (GRCh38)
Location 9:108260048-108260070
Sequence GGGAGCTGGCCAAGAGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058773308_1058773315 4 Left 1058773308 9:108260048-108260070 CCAAGGCCTCTTGGCCAGCTCCC No data
Right 1058773315 9:108260075-108260097 TCTAGCCATCACAGACACACTGG No data
1058773308_1058773318 9 Left 1058773308 9:108260048-108260070 CCAAGGCCTCTTGGCCAGCTCCC No data
Right 1058773318 9:108260080-108260102 CCATCACAGACACACTGGGCAGG No data
1058773308_1058773320 25 Left 1058773308 9:108260048-108260070 CCAAGGCCTCTTGGCCAGCTCCC No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773308_1058773319 22 Left 1058773308 9:108260048-108260070 CCAAGGCCTCTTGGCCAGCTCCC No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773308_1058773316 5 Left 1058773308 9:108260048-108260070 CCAAGGCCTCTTGGCCAGCTCCC No data
Right 1058773316 9:108260076-108260098 CTAGCCATCACAGACACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058773308 Original CRISPR GGGAGCTGGCCAAGAGGCCT TGG (reversed) Intergenic
No off target data available for this crispr