ID: 1058773316

View in Genome Browser
Species Human (GRCh38)
Location 9:108260076-108260098
Sequence CTAGCCATCACAGACACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058773309_1058773316 -1 Left 1058773309 9:108260054-108260076 CCTCTTGGCCAGCTCCCCTCCTC No data
Right 1058773316 9:108260076-108260098 CTAGCCATCACAGACACACTGGG No data
1058773308_1058773316 5 Left 1058773308 9:108260048-108260070 CCAAGGCCTCTTGGCCAGCTCCC No data
Right 1058773316 9:108260076-108260098 CTAGCCATCACAGACACACTGGG No data
1058773307_1058773316 6 Left 1058773307 9:108260047-108260069 CCCAAGGCCTCTTGGCCAGCTCC No data
Right 1058773316 9:108260076-108260098 CTAGCCATCACAGACACACTGGG No data
1058773310_1058773316 -9 Left 1058773310 9:108260062-108260084 CCAGCTCCCCTCCTCTAGCCATC No data
Right 1058773316 9:108260076-108260098 CTAGCCATCACAGACACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058773316 Original CRISPR CTAGCCATCACAGACACACT GGG Intergenic
No off target data available for this crispr