ID: 1058773319

View in Genome Browser
Species Human (GRCh38)
Location 9:108260093-108260115
Sequence ACTGGGCAGGACCCACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058773311_1058773319 2 Left 1058773311 9:108260068-108260090 CCCCTCCTCTAGCCATCACAGAC No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773307_1058773319 23 Left 1058773307 9:108260047-108260069 CCCAAGGCCTCTTGGCCAGCTCC No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773308_1058773319 22 Left 1058773308 9:108260048-108260070 CCAAGGCCTCTTGGCCAGCTCCC No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773309_1058773319 16 Left 1058773309 9:108260054-108260076 CCTCTTGGCCAGCTCCCCTCCTC No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773313_1058773319 0 Left 1058773313 9:108260070-108260092 CCTCCTCTAGCCATCACAGACAC No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773312_1058773319 1 Left 1058773312 9:108260069-108260091 CCCTCCTCTAGCCATCACAGACA No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773317_1058773319 -10 Left 1058773317 9:108260080-108260102 CCATCACAGACACACTGGGCAGG No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773314_1058773319 -3 Left 1058773314 9:108260073-108260095 CCTCTAGCCATCACAGACACACT No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data
1058773310_1058773319 8 Left 1058773310 9:108260062-108260084 CCAGCTCCCCTCCTCTAGCCATC No data
Right 1058773319 9:108260093-108260115 ACTGGGCAGGACCCACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058773319 Original CRISPR ACTGGGCAGGACCCACTGCA TGG Intergenic
No off target data available for this crispr