ID: 1058773320

View in Genome Browser
Species Human (GRCh38)
Location 9:108260096-108260118
Sequence GGGCAGGACCCACTGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058773312_1058773320 4 Left 1058773312 9:108260069-108260091 CCCTCCTCTAGCCATCACAGACA No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773313_1058773320 3 Left 1058773313 9:108260070-108260092 CCTCCTCTAGCCATCACAGACAC No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773311_1058773320 5 Left 1058773311 9:108260068-108260090 CCCCTCCTCTAGCCATCACAGAC No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773308_1058773320 25 Left 1058773308 9:108260048-108260070 CCAAGGCCTCTTGGCCAGCTCCC No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773314_1058773320 0 Left 1058773314 9:108260073-108260095 CCTCTAGCCATCACAGACACACT No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773317_1058773320 -7 Left 1058773317 9:108260080-108260102 CCATCACAGACACACTGGGCAGG No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773310_1058773320 11 Left 1058773310 9:108260062-108260084 CCAGCTCCCCTCCTCTAGCCATC No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773307_1058773320 26 Left 1058773307 9:108260047-108260069 CCCAAGGCCTCTTGGCCAGCTCC No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data
1058773309_1058773320 19 Left 1058773309 9:108260054-108260076 CCTCTTGGCCAGCTCCCCTCCTC No data
Right 1058773320 9:108260096-108260118 GGGCAGGACCCACTGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058773320 Original CRISPR GGGCAGGACCCACTGCATGG TGG Intergenic
No off target data available for this crispr