ID: 1058774908

View in Genome Browser
Species Human (GRCh38)
Location 9:108273455-108273477
Sequence TTGTGAGGCTCTCTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058774908_1058774914 12 Left 1058774908 9:108273455-108273477 CCTGAAGCCAGAGAGCCTCACAA No data
Right 1058774914 9:108273490-108273512 CCTACAAAAAGCTTTGAAAGAGG No data
1058774908_1058774915 13 Left 1058774908 9:108273455-108273477 CCTGAAGCCAGAGAGCCTCACAA No data
Right 1058774915 9:108273491-108273513 CTACAAAAAGCTTTGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058774908 Original CRISPR TTGTGAGGCTCTCTGGCTTC AGG (reversed) Intergenic
No off target data available for this crispr