ID: 1058776489

View in Genome Browser
Species Human (GRCh38)
Location 9:108289318-108289340
Sequence CTGGAGAAGCAGATGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058776489_1058776497 27 Left 1058776489 9:108289318-108289340 CCCCCTTCCATCTGCTTCTCCAG No data
Right 1058776497 9:108289368-108289390 TTATTTTGCTCCAAGTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058776489 Original CRISPR CTGGAGAAGCAGATGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr