ID: 1058777598

View in Genome Browser
Species Human (GRCh38)
Location 9:108300354-108300376
Sequence CGGTGGGCATGGAGGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058777598_1058777608 20 Left 1058777598 9:108300354-108300376 CCATCATGCCTCCATGCCCACCG No data
Right 1058777608 9:108300397-108300419 TAACACCACCTCCGTTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058777598 Original CRISPR CGGTGGGCATGGAGGCATGA TGG (reversed) Intergenic
No off target data available for this crispr