ID: 1058781161

View in Genome Browser
Species Human (GRCh38)
Location 9:108336946-108336968
Sequence GAAAGTGGCAAGGGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058781153_1058781161 14 Left 1058781153 9:108336909-108336931 CCATTCAGACTCTATTTATGATT No data
Right 1058781161 9:108336946-108336968 GAAAGTGGCAAGGGAGTGGAGGG No data
1058781152_1058781161 23 Left 1058781152 9:108336900-108336922 CCTAAGATACCATTCAGACTCTA No data
Right 1058781161 9:108336946-108336968 GAAAGTGGCAAGGGAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058781161 Original CRISPR GAAAGTGGCAAGGGAGTGGA GGG Intergenic
No off target data available for this crispr