ID: 1058783564

View in Genome Browser
Species Human (GRCh38)
Location 9:108364099-108364121
Sequence AGGGGGATATTGAGTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058783564_1058783573 9 Left 1058783564 9:108364099-108364121 CCCTCATCACTCAATATCCCCCT No data
Right 1058783573 9:108364131-108364153 CCAAAATTCCTCCCTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058783564 Original CRISPR AGGGGGATATTGAGTGATGA GGG (reversed) Intergenic
No off target data available for this crispr