ID: 1058785221

View in Genome Browser
Species Human (GRCh38)
Location 9:108380475-108380497
Sequence AGGTCTAATGGGCTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058785221_1058785226 -5 Left 1058785221 9:108380475-108380497 CCTTCCTCCAGCCCATTAGACCT No data
Right 1058785226 9:108380493-108380515 GACCTCTTGACTCAGCCCCCAGG No data
1058785221_1058785227 -4 Left 1058785221 9:108380475-108380497 CCTTCCTCCAGCCCATTAGACCT No data
Right 1058785227 9:108380494-108380516 ACCTCTTGACTCAGCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058785221 Original CRISPR AGGTCTAATGGGCTGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr