ID: 1058790488

View in Genome Browser
Species Human (GRCh38)
Location 9:108439704-108439726
Sequence GTGGCCACTGACCATTAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058790488_1058790491 16 Left 1058790488 9:108439704-108439726 CCACGCTAATGGTCAGTGGCCAC No data
Right 1058790491 9:108439743-108439765 AATATTTTGAACAAAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058790488 Original CRISPR GTGGCCACTGACCATTAGCG TGG (reversed) Intergenic
No off target data available for this crispr