ID: 1058790491

View in Genome Browser
Species Human (GRCh38)
Location 9:108439743-108439765
Sequence AATATTTTGAACAAAACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058790488_1058790491 16 Left 1058790488 9:108439704-108439726 CCACGCTAATGGTCAGTGGCCAC No data
Right 1058790491 9:108439743-108439765 AATATTTTGAACAAAACCCTAGG No data
1058790484_1058790491 29 Left 1058790484 9:108439691-108439713 CCAAAGCCTGAGTCCACGCTAAT No data
Right 1058790491 9:108439743-108439765 AATATTTTGAACAAAACCCTAGG No data
1058790490_1058790491 -8 Left 1058790490 9:108439728-108439750 CCAAAGCAGATATTTAATATTTT No data
Right 1058790491 9:108439743-108439765 AATATTTTGAACAAAACCCTAGG No data
1058790489_1058790491 -3 Left 1058790489 9:108439723-108439745 CCACGCCAAAGCAGATATTTAAT No data
Right 1058790491 9:108439743-108439765 AATATTTTGAACAAAACCCTAGG No data
1058790486_1058790491 23 Left 1058790486 9:108439697-108439719 CCTGAGTCCACGCTAATGGTCAG No data
Right 1058790491 9:108439743-108439765 AATATTTTGAACAAAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058790491 Original CRISPR AATATTTTGAACAAAACCCT AGG Intergenic
No off target data available for this crispr