ID: 1058792121

View in Genome Browser
Species Human (GRCh38)
Location 9:108458375-108458397
Sequence CAGGCTGCTTTCCTATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058792121_1058792125 15 Left 1058792121 9:108458375-108458397 CCATCAAATAGGAAAGCAGCCTG No data
Right 1058792125 9:108458413-108458435 GAATGTTCTGTACTATCTTTTGG No data
1058792121_1058792123 -7 Left 1058792121 9:108458375-108458397 CCATCAAATAGGAAAGCAGCCTG No data
Right 1058792123 9:108458391-108458413 CAGCCTGAGAATACAGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058792121 Original CRISPR CAGGCTGCTTTCCTATTTGA TGG (reversed) Intergenic
No off target data available for this crispr