ID: 1058805029

View in Genome Browser
Species Human (GRCh38)
Location 9:108582236-108582258
Sequence TCACCTCCAGGGGTTTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058805029_1058805039 2 Left 1058805029 9:108582236-108582258 CCCTCAAAAACCCCTGGAGGTGA No data
Right 1058805039 9:108582261-108582283 AGTAGGAATCTGGGAAGAGAGGG No data
1058805029_1058805036 -8 Left 1058805029 9:108582236-108582258 CCCTCAAAAACCCCTGGAGGTGA No data
Right 1058805036 9:108582251-108582273 GGAGGTGAGGAGTAGGAATCTGG No data
1058805029_1058805037 -7 Left 1058805029 9:108582236-108582258 CCCTCAAAAACCCCTGGAGGTGA No data
Right 1058805037 9:108582252-108582274 GAGGTGAGGAGTAGGAATCTGGG No data
1058805029_1058805041 21 Left 1058805029 9:108582236-108582258 CCCTCAAAAACCCCTGGAGGTGA No data
Right 1058805041 9:108582280-108582302 AGGGACAGAAATAAGAAAATGGG No data
1058805029_1058805040 20 Left 1058805029 9:108582236-108582258 CCCTCAAAAACCCCTGGAGGTGA No data
Right 1058805040 9:108582279-108582301 GAGGGACAGAAATAAGAAAATGG No data
1058805029_1058805042 22 Left 1058805029 9:108582236-108582258 CCCTCAAAAACCCCTGGAGGTGA No data
Right 1058805042 9:108582281-108582303 GGGACAGAAATAAGAAAATGGGG No data
1058805029_1058805038 1 Left 1058805029 9:108582236-108582258 CCCTCAAAAACCCCTGGAGGTGA No data
Right 1058805038 9:108582260-108582282 GAGTAGGAATCTGGGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058805029 Original CRISPR TCACCTCCAGGGGTTTTTGA GGG (reversed) Intergenic
No off target data available for this crispr