ID: 1058805630

View in Genome Browser
Species Human (GRCh38)
Location 9:108588506-108588528
Sequence GATGCTTATCCCTTTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058805630_1058805632 -7 Left 1058805630 9:108588506-108588528 CCTTCCAAAAAGGGATAAGCATC No data
Right 1058805632 9:108588522-108588544 AAGCATCACTGCAATCATTCAGG No data
1058805630_1058805633 17 Left 1058805630 9:108588506-108588528 CCTTCCAAAAAGGGATAAGCATC No data
Right 1058805633 9:108588546-108588568 AGTAATCAGAAGAGTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058805630 Original CRISPR GATGCTTATCCCTTTTTGGA AGG (reversed) Intergenic
No off target data available for this crispr