ID: 1058805744

View in Genome Browser
Species Human (GRCh38)
Location 9:108589800-108589822
Sequence ATGGAGAACAAGAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058805741_1058805744 -3 Left 1058805741 9:108589780-108589802 CCAGAGAGAGAGACAGCCAAATG No data
Right 1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058805744 Original CRISPR ATGGAGAACAAGAGTGAAGA AGG Intergenic
No off target data available for this crispr